This web page was created programmatically, to learn the article in its authentic location you possibly can go to the hyperlink bellow:
https://www.nature.com/articles/s42255-025-01368-w
and if you wish to take away this text from our website please contact us
The following CRC cell traces had been obtained from the American Type Culture Collection (ATCC): HCT116 (ATCC, CCL-247), DLD1 (ATCC, CCL-221), RKO (ATCC, CRL-2577), HCT8 (ATCC, CCL-244), NCI-H508 (ATCC, CCL-253), Colo205 (ATCC, CCL-222), SW620 (ATCC, CCL-227), SW48 (ATCC, CCL-231) and HCT15 (ATCC, CCL-225). The DiFi, GP5D and HT55 cell traces had been supplied by J. Engelman, and the VACO432 cell line was supplied by S. Markowitz. Short tandem repeat profiling was carried out to authenticate all cell traces. Cells had been cultured in high-glucose DMEM (Fisher Scientific, 11-965-118) supplemented with 10% FBS (Fisher Scientific, 26-140-079). All cultures had been maintained at 37 °C in a humidified ambiance containing 5% CO2.
Three media formulations had been used for in vitro sugar experiments. The Glu + Fru situation contained 10 mM glucose and 10 mM fructose. The Glu situation contained 20 mM glucose, and the Fru situation contained 20 mM fructose. All media had been ready utilizing glucose-free DMEM (Fisher Scientific, 11-966-025) supplemented with 10% dialysed FBS (Fisher Scientific, SH30079.03). d-Glucose (Sigma-Aldrich, G8270) and d-fructose (Sigma-Aldrich, F0127) had been added to realize the specified concentrations. For isotope-labelling metabolomics, media had been ready by changing d-glucose with [U-13C6] d-glucose (Cambridge Isotope Laboratories, CLM-1396-10) or d-fructose with [U-13C6] d-fructose (Cambridge Isotope Laboratories, CLM-1553-PK).
The migration and invasion assays had been carried out as beforehand described44. For the migration assay, 100 μl of CRC cells (6 × 105 for DLD1, 8 × 105 for HCT116, 4–5 × 105 for HCT8, 5–8 × 105 for RKO and 5 × 105 for the remaining 9 CRC cell traces) in serum-free assay medium was seeded into the cell tradition insert (higher chamber) of a transwell (Fisher Scientific, 07-200-150). The decrease chamber was crammed with 600 μl of assay medium containing 10% dialysed FBS (Fisher Scientific, SH30079.03). For chemical therapies, compounds had been added to each the higher and decrease chambers. After incubation for 48–72 h (48–72 h for DLD1 and HCT116, 48 h for HCT8, 60–72 h for RKO and 48 h for the remaining 9 CRC cell traces), the underside surfaces of the inserts had been stained with 0.1% crystal violet (Sigma-Aldrich, C0775) in 20% methanol for 10 min. Non-migrated cells on the higher facet of the membrane had been eliminated with cotton swabs earlier than evaluation.
For the invasion assay, 40 μl of 15% Matrigel (Fisher Scientific, CB40230C) in serum-free assay medium was added to the insert, and the plate was incubated at 37 °C for 30 min earlier than cell seeding. Cells had been seeded utilizing the identical numbers as within the migration assay, and the identical assay medium was added. The incubation time for the invasion assay was 24–48 h longer than for the migration assay. After incubation, the underside surfaces of the inserts had been stained with 0.1% crystal violet (Sigma-Aldrich, C0775) in 20% methanol for 10 min, and non-invaded cells on the higher facet of the membrane had been eliminated with cotton swabs earlier than evaluation.
Unless in any other case specified, the assay medium utilized in each migration and invasion assays was glucose-free DMEM supplemented with both 10 mM glucose and 10 mM fructose (Glu + Fru situation) or 20 mM glucose (Glu situation), and 10% dialysed FBS. The compounds utilized in these assays included fluvastatin (Sigma-Aldrich, PHR1620-1G), FK866 (APExBIO, A4381), (±)-mevalonolactone (a cell-permeable type of mevalonate; Sigma-Aldrich, M4667-1G), metformin (Cayman Chemical, 13118), α-ketobutyrate (Sigma-Aldrich, K401-5G) and nicotinamide (Sigma-Aldrich, N0636). All chemical doses used for migration assays had been optimized to reduce cytotoxicity, and cell numbers had been measured in parallel utilizing the SYBR Green assay underneath the identical therapy situations. Although nicotinamide and mevalonolactone didn’t induce cytotoxicity, FK866, metformin and fluvastatin confirmed delicate cytotoxic results in sure cell traces, even at optimized concentrations. Therefore, migration knowledge had been normalized to cell quantity to account for potential proliferation variations, as offered within the Extended Data. Significant suppression of migration continued after normalization, confirming that lowered motility was not solely brought on by results on cell viability. After drying the membranes, photographs had been acquired by microscopy and quantified by measuring the stained space utilizing ImageJ (v.1.54 f).
For the expansion assay, CRC cells had been seeded into 96-well plates (4,000 cells per effectively) and cultured for 1–5 days. After incubation, both the SYBR Green I assay or CellTiter-Glo Luminescent Cell Viability Assay (Promega, G7571) was used to quantify cell progress, relying on the experiment. For the SYBR Green I assay, the medium was eliminated and 50 μl of 0.2% SDS was added to every effectively, adopted by 150 μl of diluted SYBR Green I resolution (1:750 in water) (Fisher Scientific, S-7567). Fluorescence was measured utilizing a plate reader (BioTek, Synergy H1) at excitation 485 nm and emission 528 nm. For experiments utilizing CellTiter-Glo, the assay was carried out in response to the producer’s directions.
For cell viability measurements in transwell-based migration or invasion assays, the identical variety of cells used within the transwell inserts was seeded into 24-well plates. Cells had been cultured underneath an identical situations (100 μl serum-free assay medium and 600 μl assay medium with 10% dialysed FBS) and for a similar durations because the corresponding migration or invasion assays. After incubation, 200 μl of 0.2% SDS was added to every effectively. Cell lysates had been sonicated for 5 cycles (2 s on, 2 s off, 30% amplitude) utilizing a probe sonicator (Active Motif EpiShear, Q120AM) to homogenize the lysate. Then, 50 μl of the lysate was transferred to a brand new effectively, and 150 μl of diluted SYBR Green I resolution (1:750 in water) was added. Fluorescence was measured as described above utilizing the identical plate reader.
The clonogenic means of CRC cells was measured utilizing a beforehand described protocol45. In transient, 500–2,000 CRC cells per effectively had been seeded into six-well plates underneath Glu + Fru or Glu situations and cultured for 10–14 days. The medium was then eliminated, and every effectively was washed twice with 2 ml of 1× PBS. Cells had been mounted with 400 μl of methanol at room temperature (20–25 °C) for 20 min. After eradicating the methanol, 1 ml of 0.5% crystal violet (Sigma-Aldrich, C0775) in 25% methanol was added to every effectively and incubated for 40 min. The stain was then eliminated, and the wells had been washed with deionized water. Plates had been dried in a single day at room temperature, and particular person colonies in every effectively had been manually counted after picture acquisition and marking utilizing ImageJ (v.1.54f).
Male NU/J (athymic) mice (7 weeks previous ) had been bought from The Jackson Laboratory (pressure no. 002019), housed in a modified barrier facility and used for caecum orthotopic injection of CRC cells. Male and feminine NOD scid gamma (NSG) mice had been bought from The Jackson Laboratory (pressure no. 005557) and housed in a high-barrier facility optimized for immunodeficient mice. Parental and F1 technology NSG mice had been used for breeding, and F1 and F2 technology male mice had been used for colon mucosal and splenic injection of CRC cells. All mice had been housed in a managed setting (22 ± 1 °C, 60–70% humidity, 12 h mild–darkish cycle) and fed advert libitum with commonplace chow (Picolab Rodent Diet 20, 5053).
For sugar therapy experiments, mice got advert libitum entry to both faucet water, glucose resolution (100 g glucose in 400 ml autoclaved faucet water; 25% w/v) or Glu + Fru resolution (45 g glucose + 55 g fructose in 400 ml autoclaved faucet water; 25% w/v). These particular water bottles had been modified twice per week. In separate research, mice acquired day by day oral gavage with Glu + Fru (45 mg glucose + 55 mg fructose in 400 μl faucet water), glucose alone (100 mg in 400 μl faucet water) or faucet water alone (400 μl). All faucet water used for mouse therapies was autoclaved.
All animal experiments had been permitted by the Institutional Animal Care and Use Committees (IACUC) of Baylor College of Medicine (BCM) and the MD Anderson Cancer Center. The maximal tumour burden permitted by the IACUC (≤5 mm diameter for oral, head, neck and osseous tumours) was not exceeded on this research.
The caecum orthotopic injection of CRC cells into the NU/J mice was carried out as beforehand described46. Male NU/J mice (8 weeks previous) with related physique weights had been randomly assigned to experimental teams. Before surgical procedure, mice had been administered preemptive analgesia with buprenorphine ER (ZooPharm LLC, Rx 255459) and meloxicam (Covetrus, 11695-6936-1), and anaesthetized with 3% isoflurane (Covetrus, 11695-6777-2) in 2 l min−1 oxygen. The stomach surgical website was sterilized, and a 1–2 cm incision was made within the pores and skin and stomach wall musculature to show the caecum. A single-cell suspension of two × 106 CRC cells in 30 μl of 100% prechilled Matrigel (Corning, CB40230C) was rigorously injected into the caecal wall utilizing 29-gauge insulin syringes (BD Medical, 324702). Excess tumour cells had been gently eliminated utilizing saline-moistened sterile gauze. The caecum was returned to the stomach cavity, and the incision was closed utilizing absorbable polyglycolic acid 4-0 suture (Ethicon, J303H) and wound clips (CellLevel Scientific, 201-1000). Analgesic medication had been administered for 3 days postoperatively, and wound clips had been eliminated after 10 days. Body weight and meals and water consumption had been recorded weekly. After 4–6 weeks, all mice from the identical cohort had been killed on the identical date, and necropsies had been carried out to look at tumour metastasis and acquire tissues.
Intrasplenic injection of CRC cells was carried out following the beforehand described protocol47. NSG mice (8 weeks previous) with related physique weights had been randomly assigned to experimental teams. Before surgical procedure, mice had been administered preemptive analgesia with buprenorphine ER (ZooPharm LLC, Rx 255459) and meloxicam (Covetrus, 11695-6936-1), and anaesthetized with 3% isoflurane (Covetrus, 11695-6777-2) in 2 l min−1 oxygen. The left stomach facet, beforehand shaved, was sterilized utilizing three alternating scrubs with 5% povidone–iodine resolution (Veterinary Betadine, 67618-154-16) and alcohol prep pads (Covidien, 6818). A 1 cm incision was made within the pores and skin and stomach wall musculature on the estimated location of the spleen. The spleen was uncovered and gently ligated with absorbable polyglycolic acid 4-0 suture. A single-cell suspension of seven × 105 CRC cells in 30 μl of PBS was injected into the spleen utilizing a 30-gauge syringe (BD, 305106). The spleen was then remoted with the suture and eliminated utilizing a low-temperature cautery (World Precision Instruments, 500390). The stomach wall was closed with absorbable suture (Ethicon, J303H), and the pores and skin was closed with wound clips (CellLevel Scientific, 201-1000). Analgesic medication had been administered for 3 days postoperatively, and wound clips had been eliminated after 10 days. Body weight and meals and water consumption had been recorded weekly. The Lumina In Vivo Imaging System (IVIS) was used to watch the bioluminescence of labelled cells every week. After 4–6 weeks, all mice from the identical cohort had been killed on the identical date, and necropsies had been carried out to look at tumour metastasis and acquire tissues.
The colonoscopy-based colonic mucosal injection of CRC cells was carried out as beforehand described18. First, the colonoscopy system—consisting of a miniature endoscope (1.9 mm outer diameter), a xenon mild supply, a triple-chip digital camera and an air pump (Karl Storz, Tuttlingen, Germany)—was arrange. NSG mice (8 weeks previous) with related physique weights had been randomly assigned to experimental teams. Before the experiment, mice had been anaesthetized utilizing 3% isoflurane (Covetrus, 11695-6777-2) in 2 l min−1 oxygen, and the colonoscope was inserted about 2 cm into the rectum. A sterile 30-gauge needle hooked up to plastic tubing (supplied with the colonoscope) was inserted into the working channel, and the needle was superior into the colonic wall at a 45-degree angle. A single-cell suspension of 1 × 105 CRC cells in 40 μl of PBS was injected into the colonic wall (20 μl per website, two websites per mouse). Body weight and meals and water consumption had been recorded weekly. Colonoscopy was used weekly to visualise colonic tumours after cell implantation. After 4 weeks, all mice from the identical cohort had been killed on the identical date, and necropsies had been carried out to look at tumour metastasis and acquire tissues.
Mice implanted with luciferase-expressing most cancers cells had been intraperitoneally injected with 100 μl of 15 mg ml−1 luciferin (Gold Biotechnology, LUCK-1G) per mouse. Then, 7 min later, mice had been anaesthetized utilizing the XGI-8 Gas Anesthesia System (PerkinElmer, XGI-8) with 3% isoflurane (Covetrus, 11695-6777-2) in 2 l min−1 oxygen. Then, 10 min after luciferin injection, mice had been transferred to the Lumina IVIS (PerkinElmer). Images with publicity occasions of 1 s, 5 s, 10 s, 30 s, 1 min and a couple of min had been acquired in response to the tools handbook and used for additional evaluation. For liver imaging, 10 min after luciferin injection, mice had been killed utilizing CO2, and livers had been instantly collected and positioned within the Lumina IVIS. Images with publicity occasions of two s, 5 s and 10 s had been recorded and used for additional evaluation. Total luminescence values had been quantified utilizing Aura Software (Spectral Instruments Imaging, Aura Software, v.4.0.7).
In the FK866 therapy experiment, mice had been handled with 10 mg kg−1 FK866 (APExBIO, A4381) in PBS (Corning, MT 21-040-CV) containing 2% dimethylsulfoxide (DMSO) (Sigma-Aldrich, D4540) by intraperitoneal injection. In the simvastatin therapy experiment, mice had been handled with 30 mg kg−1 day−1 simvastatin (Selleckchem, S1792) in PBS containing 10% DMSO by oral gavage. During the drug therapy interval, mice had advert libitum entry to the Glu + Fru resolution (25% w/v, 45:55 ratio) of their consuming water.
Mouse tissues had been positioned in tissue cassettes (Thermo, 22-272417) and glued in 4% paraformaldehyde in PBS (Santa Cruz, sc-281692) for twenty-four h at 4 °C. Tissues had been then transferred to 70% ethanol (VWR, 89125-188) earlier than processing. Tissue processing, embedding, sectioning and H&E staining had been carried out by the BCM Breast Cancer Histology Core at BCM. Stained slides had been scanned by HistoWiz for bright-field whole-slide scanning.
Human tissue slides for H&E and SORD immunohistochemistry (IHC) staining had been obtained from the Human Tissue Acquisition and Pathology (HTAP) Services at BCM. All authentic tumour tissues and matched regular tissues (not all samples included matched regular tissues) had been collected on the Michael E. DeBakey Veterans Affairs Hospital, Ben Taub General Hospital and Baylor St. Luke’s Medical Center. Tissue acquisition was based mostly on a system designed to maximise the variety of tissues accessible from BCM-affiliated establishments. The course of started with a affected person tissue advocate who recognized all tissues with the potential to be banked for HTAP every day. A redundant consenting protocol, which included a number of makes an attempt to acquire affected person consent, was used. After assortment, tissues had been barcoded, organized, catalogued and banked within the tissue database. H&E and IHC staining of human tissues had been carried out by the BCM Breast Cancer Histology Core. The SORD antibody (Sigma-Aldrich, HPA040621) used for IHC staining was validated on SORD KO and SORD-proficient xenograft mouse tissues earlier than utility on human slides to make sure antibody specificity. Stained slides had been scanned by HistoWiz for bright-field whole-slide scanning.
Human colon tumour organoids had been supplied by M. L. Martin at Weill Cornell Medicine (the Englander Institute for Precision Medicine), and human regular colon organoids (additionally known as enteroids) had been acquired from BCM (Gastrointestinal Experimental Model Systems Core). All 3D cultures of organoids had been maintained in 15 μl per drop, totalling 5 drops (75 μl per effectively) of Matrigel (Gibco, CB40230C) in 12-well plates (Life Technologies, 150628) with 1 ml of the next medium in a 37 °C, 5% CO2 humidified incubator. The medium was modified each 2 days, and organoids and enteroids had been passaged at a 1:6 ratio when crowded.
The medium for culturing human colon tumour organoids contained the next elements: Advanced DMEM/F12 (Gibco, 12634010), B27 Supplement (Invitrogen, 17504001) at 1× focus, l-glutamine (Gibco, 25030164) at 2 mM, HEPES (Amresco, J848) at 10 mM, Primocin (Invitrogen, NC9141851) at 100 μg ml−1, human recombinant EGF (R&D Systems, 236-EG-200) at 50 ng ml−1, Gastrin I (Sigma-Aldrich, SCP0152) at 10 nM, Y-27632 (cAMP inhibitor; Selleck Chemicals, S1049) at 10 μM, A-83-01 (TGF-β inhibitor; R&D Systems, 2939) at 500 nM, SB202190 (MAPK inhibitor; Selleck Chemicals, S1077) at 3 μM, nicotinamide (Sigma-Aldrich, N3376) at 10 mM, N-acetylcysteine (Sigma-Aldrich, A9165) at 1.25 mM, prostaglandin E2 (Sigma-Aldrich, P0409) at 10 nM, Noggin (10% conditioned medium), R-spondin (10% conditioned medium) and penicillin–streptomycin (Gibco, 15140-122) at 1× focus.
The medium for culturing human colon organoids contained the next elements: Advanced DMEM/F12 (Gibco, 12634010), B27 Supplement (Invitrogen, 17504001) at 1× focus, l-glutamine (Gibco, 25030164) at 2 mM, HEPES (Amresco, J848) at 10 mM, Primocin (Invitrogen, NC9141851) at 100 μg ml−1, human recombinant EGF (R&D Systems, 236-EG-200) at 50 ng ml−1, Gastrin I (Sigma-Aldrich, SCP0152) at 10 nM, Y-27632 (cAMP inhibitor; Selleck Chemicals, S1049) at 10 μM, A-83-01 (TGF-β inhibitor; R&D Systems, 2939) at 500 nM, SB202190 (MAPK inhibitor; Selleck Chemicals, S1077) at 10 μM, nicotinamide (Sigma-Aldrich, N3376) at 10 mM, N-acetylcysteine (Sigma-Aldrich, A9165) at 1 mM, prostaglandin E2 (Sigma-Aldrich, P0409) at 10 nM, penicillin–streptomycin (Gibco, 15140-122) at 1× focus, Noggin conditioned medium (10%), R-spondin conditioned medium (10%) and WNT-3A conditioned medium (30%).
The collagen IV inventory resolution was ready by dissolving collagen IV (1 mg ml−1; Sigma-Aldrich, C5533-5MG) in 100 mM acetic acid (0.6% acetic acid in H2O). A 24-well plate was coated with 500 μl per effectively of the collagen working resolution (ready by diluting the collagen IV inventory 1:30 (v/v) in ice-cold water) and incubated at 37 °C for 1.5 h. Three-dimensional cultured enteroids had been dissociated utilizing 500 μl per effectively of 0.5 mM EDTA (Fisher, BP24821) diluted in PBS. Enteroids from one effectively of a 12-well plate (roughly 75 μl) had been used to seed one effectively of a 24-well plate. After centrifugation at 300g at 4 °C for five min, the pellet was resuspended in 500 μl of 0.05% trypsin and 0.5 mM EDTA and incubated at 37 °C for five min. Then, 1 ml of DMEM/F12 supplemented with 10% FBS was added, and the combination was pipetted 60 occasions to dissociate the cells. Following centrifugation at 400g at 4 °C for five min, the enteroid pellet was resuspended in 500 μl of enteroid medium and seeded onto the coated plate. After 1 day, the medium was changed with differentiation medium missing R-spondin, WNT-3A, nicotinamide and SB202190, and the share of Noggin conditioned medium was lowered to five%. The medium was refreshed each 2 days.
RNA from organoids, enteroids and 2D-differentiated enteroids was extracted utilizing the RNeasy Plus Mini Kit (Qiagen, 74136), and cDNA was synthesized utilizing the SuperScript IV VILO Kit (Fisher, 11756050) following the producer’s directions. Real-time qPCR was carried out utilizing amfiSure qGreen Q-PCR Master Mix (GenDEPOT, Q5600-010) on a CFX96 Real-Time System (Bio-Rad). Primers for qPCR included ACTB1 F, GCAAAGACCTGTACGCCAAC; ACTB1 R, ACATCTGCTGGAAGGTGGAC; SORD F, GGCTCTGAGATGACCACCGT; SORD R, GGTCACACTTGAGCATGATTTTCA; LGR5 F, CCTGCTTGACTTTGAGGAAGACC; and LGR5 R, CCAGCCATCAAGCAGGTGTTCA. All primers had been ordered from Thermo Fisher Scientific.
CRISPR–Cas9-mediated genome modifying was used to generate SORD KO cell traces48. The gRNA sequences (sgSORD-1, AGCAAAGTGACCATCCCGAT; sgSORD-2, TTGTTTAGGGCCAATCGGGA; sgAKR1B1-1, TCAGGTCGCTGAGTGTCTTC; sgAKR1B1-2, TCCCATACCTTAAAGCCAGT) had been cloned into the lentiCRISPRv2-puro plasmid (Addgene, 98290) utilizing the restriction enzyme BsmBI (Thermo, FD0454). The plasmids had been then packaged into lentivirus and transduced into CRC cell traces.
Pre-designed quick hairpin RNA (shRNA) plasmids for SORD knockdown—together with SORD shRNA1 (TRC Clone ID, TRCN0000028069; goal sequence, GAGAACTATCCTATCCCTGAA), SORD shRNA2 (TRC Clone ID, TRCN0000028052; goal sequence, GCCAATCGGGATGGTCACTTT) and SORD shRNA3 (TRC Clone ID, TRCN0000028106; goal sequence, CGTCCAAGTCTGTGAATGTAA)—had been bought from MilliporeSigma. These plasmids had been additionally packaged into lentivirus and transduced into CRC cell traces.
The LbNOX open studying body was amplified from pUC57-LbNOX (Addgene, 75285) by PCR20,21 utilizing the next primers: F, TCTAGAATGAAGGTCACCGTGGTCGG; R, GTTCGAATTACTTGTCATCGTCATCCTTGTAA. The open studying body was then cloned into the pCDH-EF1-MCS-IRES-copGFP plasmid (System Biosciences, CD530A-2) for LbNOX overexpression. Plasmids had been transfected into cell traces utilizing Lipofectamine (Invitrogen, 100022050 and 100022057). GFP-positive cells had been sorted by circulation cytometry (Beckman, CytoFLEX SRT) and used for subsequent experiments.
Plasmids had been co-transfected with d8.2 (Addgene, 8455) and VSVG (Addgene, 8454) at a ratio of 1:1:0.1 into HEK293T cells utilizing threefold (m/m) polyethylenimine (Sigma-Aldrich, 764965). After 2 days of tradition at 37 °C with 5% CO2, the medium was collected, filtered by a 0.45 μm filter (Millipore, SLHVM33RS) and saved at −80 °C earlier than use. HCT116, DLD1, HCT8 and RKO CRC cell traces had been contaminated with the packaged lentivirus, and optimistic cells had been chosen with puromycin (InvivoGen, ant-pr-5) on the following concentrations: 2 μg ml−1 for DLD1, 1 μg ml−1 for HCT116, 15 μg ml−1 for HCT8 and 1 μg ml−1 for RKO.
Proteins had been extracted from tissues or cells utilizing RIPA buffer (Cell Signaling Technology, 9806S) containing a protease inhibitor cocktail (GenDEPOT, P3100-001), separated on 4–20% Criterion TGX Stain-Free Gels (Bio-Rad, 5678094 and 5678095) and transferred to 0.45 μm PVDF membranes (MilliporeSigma, IPVH00010). Membranes had been probed with major antibodies at 4 °C in a single day and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for 1 h. Protein bands had been visualized utilizing ECL western blotting substrates (Bio-Rad, 1705060 and 1705062) and imaged utilizing the ChemiDoc Imaging System (Bio-Rad).
The antibodies used included SORD (1:1,000; Proteintech, 15881-1-AP), AKR1B1 (1:1,000; Proteintech, 15439-1-AP), β-actin (1:2,000; Cell Signaling Technology, 3700), goat anti-rabbit IgG(H+L)-HRP (1:5,000; GenDEPOT, SA002) and goat anti-mouse IgG(H+L)-HRP (1:5,000, GenDEPOT, SA001).
Cells had been plated in six-well dishes with commonplace DMEM + 10% FBS and cultured in a single day. Treatments had been utilized the next day and continued for twenty-four h. Cells had been then washed with PBS and extracted in 200 μl of ice-cold lysis buffer (1% dodecyltrimethylammonium bromide (Sigma-Aldrich, D8638) in 0.2 N NaOH), diluted 1:1 with PBS and centrifuged at 15,000g for five min. For NADH measurement, 20 μl of lysate was transferred to PCR tubes and incubated at 75 °C for 30 min. For NAD⁺ measurement, 20 μl of lysate was transferred to PCR tubes, then 20 μl of lysis buffer and 20 μl of 0.4 N HCl had been added, adopted by incubation at 60 °C for 20 min. After the respective incubations, samples had been cooled to room temperature and quenched with the suitable neutralizing resolution: 20 μl of 0.25 M Tris in 0.2 N HCl for NADH and 20 μl of 0.5 M Tris base for NAD⁺. Following pattern preparation, enzyme-linked luminescence-based detection of NAD⁺ and NADH was carried out in response to the producer’s directions utilizing the NAD⁺/NADH-Glo Assay Kit (Promega, G9071).
The cytosolic Peredox NADH biosensor plasmid (Addgene, 32383) was bought from Addgene and transiently transfected into CRC cell traces utilizing Lipofectamine 3000 (Thermo Fisher, L3000008) 24 h earlier than sugar therapy. Transfected cells had been incubated underneath Glu + Fru situations for twenty-four h. Green (excitation, 395/25 nm; emission, 525/34 nm) and crimson (excitation, 555/15 nm, emission, 605/52 nm) fluorescence channels had been acquired utilizing the Eclipse Ti2 inverted Nikon microscope geared up with the Photometrics Prime 95B Scientific CMOS monochrome digital camera, Lumencor Spectra X mild engine and OKO Labs micro-incubator, positioned on the Basic Sciences Research Building Microscopy Core, Department of Genetics, MD Anderson Cancer Center. Fluorescence intensities had been quantified utilizing NIS-Elements Imaging Software (v.5.42.03) as beforehand described19,49
Carbon metabolism metabolites, together with intermediates from glycolysis and the TCA cycle in addition to sugars similar to glucose, fructose and sorbitol, had been detected by LC–MS utilizing a beforehand established protocol50,51. For isotope-labelling experiments, cells had been handled with glucose-free DMEM (Gibco, 11966025) supplemented with both unlabelled d-fructose (Sigma-Aldrich, F0127) and d-glucose (Sigma-Aldrich, G8270) or 13C6 d-fructose (Cambridge Isotope Laboratories, CLM-1553-PK) and 13C6 d-glucose (Cambridge Isotope Laboratories, CLM-1396-10). Cell extracts had been ready by including 400 μl of 40:40:20 acetonitrile (ACN):methanol:water containing 0.5% formic acid to every effectively of a six-well plate, adopted by neutralization with 35.2 μl of 15% ammonium bicarbonate. After centrifugation at 20,000g for 15 min at 4 °C, the supernatants had been transferred to pattern vials (Thermo, 2-SVWGK) for LC–MS evaluation. High-performance LC was carried out utilizing an XBridge BEH Amide XP Column (Waters, 186006724). Mobile part A consisted of 5% ACN with 20 mM ammonium acetate and 20 mM ammonium hydroxide (pH 9.75–9.85); cell part B was 100% ACN. The column temperature was maintained at 25 °C, and the circulation price was 0.15 ml min−1. The LC gradient was as follows: 0 min, 85% B; 2 min, 85% B; 3 min, 80% B; 5 min, 80% B; 6 min, 75% B; 7 min, 75% B; 8 min, 70% B; 9 min, 70% B; 10 min, 50% B; 12 min, 50% B; 13 min, 25% B; 16 min, 25% B; 18 min, 0% B; 23 min, 0% B; 24 min, 85% B; and 30 min, 85% B. MS was carried out on a Q Exactive Orbitrap Mass Spectrometer (Thermo) in each optimistic and unfavorable ion modes. Data had been processed and analysed utilizing TraceFinder software program (Thermo, OPTON-31001).
Untargeted international metabolomics evaluation utilizing LC–tandem MS (MS/MS), measuring greater than 700 metabolites, was carried out as beforehand described9. Specifically, 600 μl of −20 °C 3 mM antioxidant monobromobimane (Fisher Scientific, M20381) in methanol (80:20, v/v) was added to cell samples and incubated for two h at room temperature, adopted by 1 h of incubation at 0 °C. Samples had been then centrifuged for 15 min at 16,000g, and supernatants had been transferred to scrub tubes. This extraction step was repeated two further occasions, and the mixed supernatants had been dried utilizing a SpeedVac (Savant) and saved at −80 °C till evaluation. For normalization, post-extraction tissue or tumour pellets had been solubilized in 800 μl of 0.2 M aqueous NaOH at 95 °C for 60 min, and protein content material was quantified utilizing the BCA Assay (Thermo, PI23227). For metabolite evaluation, dried extracts had been reconstituted in ACN (70:30, v/v) containing 0.025% acetic acid, and three μl of the answer was injected for LC–MS. Metabolite profiling was carried out utilizing an Agilent 1200 LC system coupled to an Agilent 6230 time-of-flight mass analyser. Chromatographic separation was achieved utilizing aqueous normal-phase gradient separation on a Diamond Hydride column (Microsolv). Mobile part A consisted of 6 μM EDTA and 0.025% acetic acid in isopropanol (50:50, v/v); cell part B consisted of 6 μM EDTA and 5 mM ammonium acetate in ACN (90:10, v/v). The following LC gradient was utilized: 0–1.0 min, 99% B; 1.0–15.0 min, 20% B; 15.1–29.0 min, 0% B; and 29.1–37.0 min, 99% B. Both optimistic and unfavorable ion mass spectra had been acquired in 2 GHz (prolonged dynamic vary) mode at 1.41 spectra per second over a mass/cost vary of 40–1400 m/z. Data had been saved in each centroid and profile modes utilizing Agilent MassHunter Workstation B.06.00 Data Acquisition Software. Raw knowledge recordsdata had been analysed utilizing Mass Profiler Professional (Agilent, v.B.14.5) and MassHunter Profinder (Agilent, v.B.08.00).
For focused metabolomics, cell lysates had been extracted twice with 500 μl of 80% ice-cold methanol. After centrifugation at 20,000g for 20 min at 4 °C, the supernatants had been dried and reconstituted in 15 μl of LC–MS-grade water, then transferred to pattern vials (Thermo, 2-SVWGK). LC–MS/MS and knowledge evaluation for untargeted polar metabolomics had been carried out by the BIDMC Mass Spectrometry Core Facility at Beth Israel Deaconess Medical Center, as beforehand described52. Absolute quantification of mevalonate pathway metabolites was carried out by Creative Proteomics utilizing LC–MS. In transient, samples had been extracted with 80% methanol as described above, reconstituted in 20 μl of high-performance LC-grade water and 5–7 μl was injected right into a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu). Metabolites had been analysed by chosen response monitoring (SRM), focusing on a panel of 300 endogenous water-soluble metabolites. Some metabolites had been detected in each optimistic and unfavorable ion modes, yielding a complete of 311 SRM transitions utilizing polarity switching. The electrospray ionization voltage was +4950 V in optimistic mode and −4,500 V in unfavorable mode. The dwell time was 3 ms per SRM transition, and complete cycle time was 1.55 s. Approximately 9–12 knowledge factors had been acquired per detected metabolite.
For mevalonate pathway metabolite measurements, cells cultured in 10 cm dishes had been washed with 5 ml chilly PBS and extracted with 1 ml of 80% methanol, then positioned on ice for 1 h. The extracts had been centrifuged at 16,000g for 15 min, and 100 μl of the supernatant was saved for evaluation. The remaining 900 μl was dried utilizing a SpeedVac (Eppendorf, Vacufuge) and reconstituted in 80 μl of 80% methanol. For LC–MS evaluation, 5 μl of each unconcentrated and concentrated samples was injected. LC was carried out utilizing an XBridge BEH Amide XP Column (Waters, 186006724). Mobile part A consisted of 5% ACN with 20 mM ammonium acetate and 20 mM ammonium hydroxide (pH 9.75–9.85); cell part B was 100% ACN. The column was maintained at 25 °C, and the circulation price was 0.15 ml min−1. The LC gradient was as follows: 0 min, 85% B; 2 min, 85% B; 3 min, 80% B; 5 min, 80% B; 6 min, 75% B; 7 min, 75% B; 8 min, 70% B; 9 min, 70% B; 10 min, 50% B; 12 min, 50% B; 13 min, 25% B; 16 min, 25% B; 18 min, 0% B; 23 min, 0% B; 24 min, 85% B; and 30 min, 85% B. MS was carried out utilizing a Q Exactive Orbitrap Mass Spectrometer (Thermo) in unfavorable ion mode. Data had been processed and analysed utilizing TraceFinder software program (Thermo, OPTON-31001).
For the measurement of sorbitol in each cells and medium at totally different time factors, cells had been cultured in six-well plates underneath the indicated situations, as proven within the figures. At the tip of therapy, 1 ml of medium was combined with 3 ml of methanol and centrifuged at 16,000g for 20 min. The supernatants had been then dried utilizing a SpeedVac (Eppendorf, Vacufuge) and reconstituted in 400 μl of 80% methanol per pattern by 10 min of water-bath sonication (Branson, 2800). Samples had been centrifuged at 16,000g for 20 min, and 5 μl of the supernatant was used for LC–MS injection. Meanwhile, the remaining medium was eliminated, and cells had been washed with 2 ml of chilly PBS, then extracted with 1 ml of 80% methanol and positioned on ice for 1 h. The extracts had been centrifuged at 16,000g for 15 min, and 5 μl of the supernatant was used for LC–MS injection. LC was carried out utilizing an XBridge BEH Amide XP column (Waters, 186006724) underneath unfavorable ion mode, as described above for mevalonate pathway metabolite measurements. MS was carried out utilizing a Q Exactive Orbitrap mass spectrometer system (Thermo), and knowledge had been processed and analysed utilizing TraceFinder software program (Thermo, OPTON-31001).
Total RNA was extracted from SORD WT (Cas9-expressing management cells) and KO cells derived from HCT116 and DLD1 utilizing the RNeasy Plus Mini Kit (Qiagen, 74136). Before RNA extraction, cells had been cultured underneath Glu + Fru situations for 48 h. Sample high quality management, RNA-seq and knowledge evaluation had been carried out by Novogene. In transient, after isolation, RNA integrity and quantification had been assessed utilizing the RNA Nano 6000 Assay Kit with the Bioanalyzer 2100 system (Agilent Technologies). Qualified samples had an RNA Integrity Number worth of >10. Libraries had been generated utilizing the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, E7530L) following the producer’s protocols, with index codes added. Clustering of the index-coded samples was carried out on a cBot Cluster Generation System utilizing the PE Cluster Kit cBot-HS (Illumina), in response to the producer’s directions. After cluster technology, library preparations had been sequenced on an Illumina platform to generate paired-end reads. Following high quality management checks for Q20, Q30 and GC content material, the paired-end clear reads had been aligned to the reference genome utilizing STAR (Spliced Transcripts Alignment to a Reference). Gene-level quantification was carried out with FeatureCounts, and differential expression evaluation was carried out utilizing the DESeq2 R package deal. Differentially expressed genes had been recognized utilizing the edgeR R package deal; these with a false discovery price of <0.05 and |log2(fold change)| > 0.5 had been used for pathway evaluation with Qiagen Ingenuity Pathway Analysis. Heatmaps had been generated utilizing Qlucore (v.3.9). The R code used to course of the RNA-seq knowledge is offered upon request.
Gene expression knowledge from human CRCs and adjoining regular tissues (GSE41258, GSE14297, GSE49355 and GSE35834) had been obtained from the Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo). Data from The Cancer Genome Atlas Pan-Cancer dataset had been obtained from the UCSC Xena database. OncoGEO B37 and B38 datasets had been obtained from QIAGEN OmicSoft Lands. The expression ranges of SORD and AKR1B1 in regular tissue, major tumour and metastatic tumour teams had been extracted from these datasets and in contrast utilizing unpaired t-tests or one-way ANOVA. Analysis of scRNA-seq knowledge was carried out utilizing the Human Colon Cancer Atlas (c295) dataset through the Single Cell Portal (https://singlecell.broadinstitute.org/single_cell)
All animals had been randomly grouped. No statistical strategies had been used to pre-determine pattern sizes, however our pattern sizes are just like these reported in earlier publications9,33. Data assortment and evaluation in mice weren’t carried out blind to the experimental situations. In the animal experiments, mice that died prematurely or didn’t develop major colon tumours (owing to injection points) had been excluded from evaluation. In Extended Data Fig. 3a,g (public gene expression knowledge), one outlier knowledge level (|x − μ| > 6σ) per determine was excluded for graphical functions, and this exclusion didn’t have an effect on the P worth or interpretation. No knowledge had been excluded from different analyses.
All knowledge are proven as means; error bars, s.e.m. Data distribution was assumed to be regular, however this was not formally examined. When evaluating means between two teams, a two-tailed unpaired t-test was used after confirming that the information had been sampled from a Gaussian distribution utilizing the D’Agostino–Pearson normality check. When evaluating means throughout greater than two teams, a one-way ANOVA was carried out utilizing Prism 10 (GraphPad). For evaluating the consequences of genotype and therapy, two-way ANOVA was carried out with put up hoc comparisons utilizing Holm’s a number of comparisons check in Prism 10 (GraphPad). Statistical significance is proven as *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001. The Venn diagrams in Fig. 2 and Extended Data Fig. 3 had been generated in https://bioinformatics.psb.ugent.be/webtools/Venn/.
Further data on analysis design is offered within the Nature Portfolio Reporting Summary linked to this text.
This web page was created programmatically, to learn the article in its authentic location you possibly can go to the hyperlink bellow:
https://www.nature.com/articles/s42255-025-01368-w
and if you wish to take away this text from our website please contact us
This web page was created programmatically, to learn the article in its authentic location you…
This web page was created programmatically, to learn the article in its unique location you…
This web page was created programmatically, to learn the article in its authentic location you…
This web page was created programmatically, to learn the article in its authentic location you…
This web page was created programmatically, to learn the article in its authentic location you'll…
This web page was created programmatically, to learn the article in its authentic location you…